Página 1 dos resultados de 250 itens digitais encontrados em 0.001 segundos

Análise do ITS1 do DNA ribossômico em espécies do complexo Anastrepha fraterculus (Diptera: Tephritidae); Analysis of ITS1 of ribosomal DNA in Species of the Anastrepha fraterculus complex (Diptera: Tephritidae).

Prezotto, Leandro Fontes
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 14/04/2008 Português
Relevância na Pesquisa
As espécies de moscas-das-frutas da família Tephritidae são consideradas importantes pragas da fruticultura mundial por utilizarem vários frutos de valor comercial como substrato para desenvolvimento do seu estágio de larva. O gênero Anastrepha é endêmico do Continente Americano e compreende cerca de 200 espécies descritas, das quais 99 ocorrem no Brasil. Dentre essas espécies, destaca-se a espécie nominal Anastrepha fraterculus (sensu lato), que compreende um complexo de espécies crípticas, quatro das quais foram reconhecidas, até o momento, A. sp.1, A. sp.2 e A. sp.3 (Brasil) e A. sp.4 encontrada no Equador. O presente trabalho buscou a caracterização da variabilidade do espaçador ITS1 do DNA ribossômico de A. sp.1, A. sp.2 e A. sp.3 em amostras populacionais de diversas localidades do Brasil e a análise desse espaçador em amostras de outras regiões das Américas do Sul, Central e México. O ITS1 mostrou ser um marcador bastante útil para análises filogenéticas entre espécies próximas. Os fragmentos amplificados com os iniciadores 18SF e 5.8SR, construídos neste trabalho, continham cerca de 900 pb, não havendo diferenças significativas entre as amostras. Os fragmentos continham uma seqüência parcial do gene 18S...

Zoneamento ecológico de Anastrepha fraterculus e Ceratitis capitata (Diptera: Tephritidae) em dois cenários climáticos no Brasil; Ecological zoning for Anastrepha fraterculus and Ceratitis capitata (Diptera, Tephritidae) in two climatic scenarios in Brazil

Santos, Wyratan da Silva
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 28/02/2008 Português
Relevância na Pesquisa
O zoneamento ecológico exploratório de Anastrepha fraterculus e de Ceratitis capitata foi baseado nos dados climáticos de 497 estações meteorológicas de todo o Brasil para o clima recente (1961 - 1990) e nos dados climáticos previstos pelo IPCC para o clima futuro (2080 no cenário A2). Com esses dados, foram confeccionados evapluviogramas para calcular o índice de desenvolvimento das duas espécies, com base em suas necessidades térmicas e de umidade de solo. Os índices de desenvolvimento foram espacializados pelo sistema de informações geográficas SPRING 4.1.1 e divididos em cinco classes. As localidades mais propícias ao desenvolvimento de A. fraterculus, no clima recente, localizam-se nas regiões Sudeste e Sul. Essas regiões apresentam temperaturas médias mensais dentro da faixa mesotérmica de desenvolvimento da espécie e período curto de estiagem. Por outro lado, as localidades com condições menos favoráveis estão no semi-árido da região Nordeste, onde as temperaturas ficam sempre acima da temperatura-limite de desenvolvimento da mosca-das-frutas sul-americana e as condições hídricas são inadequadas ao desenvolvimento da fase de pupa. Com o aumento da temperatura, devido ao aquecimento global previsto para 2080 (cenário A2)...

Influência da umidade em quatro tipos de solo no desenvolvimento pupal de Ceratitis capitata (Wiedemann, 1824), Anastrepha fraterculus (Wiedemann, 1830), do parasitóide Diachasmimorpha longicaudata (Ashmed, 1905) e de Gymnandrosoma aurantianum Lima, 1927.; The influence of moisture on four soil types in the pupal development of Ceratitis capitata (Wiedemann, 1824), Anastrepha fraterculus (Wiedemann, 1830), of parasitoid Diachasmimorpha longicaudata (Ashmed, 1905) and Gymnandrosoma aurantianum Lima, 1927.

Bento, Flavia de Moura Manoel
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 15/05/2008 Português
Relevância na Pesquisa
Este trabalho teve como objetivo avaliar o efeito da umidade em quatro tipos de solos sobre a emergência de adultos e duração da fase pupal das moscas-das-frutas, Ceratitis capitata (Wiedemann, 1824) e Anastrepha fraterculus (Wiedemann, 1830) e do bicho-furão dos citros, Gymnandrosoma aurantianum Lima, 1927 e na emergência do parasitóide de moscas-das-frutas, Diachasmimorpha longicaudata (Ashmed, 1905), utilizando-se diferentes potenciais mátricos de água no solo e com uma metodologia própria e desenvolvida no presente trabalho. As profundidades de pupação de G. aurantianum e A. fraterculus foram estudadas em tratamento seco e úmido (5%), com a finalidade de se determinar a profundidade adequada para cada espécie utilizada nos experimentos de avaliação da influência da umidade em quatro tipos de solo. G. aurantianum pupou na mesma profundidade em substrato úmido ou seco. A pupação de A. fraterculus é mais superficial em condições secas, com 100% de pupação entre 0 e 1,5 cm. Para C. capitata, a profundidade utilizada no experimento de influência da umidade e do tipo de solo foi a de 3,0 cm. A duração da fase pupal desta espécie foi influenciada diferentemente para machos e fêmeas. Para fêmeas, apenas o tipo de solo influenciou a duração da fase pupal...

Esterilização de moscas-das-frutas (Diptera: Tephritidae) com raios-X para Programas de Técnica do Inseto Estéril; Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for Sterile Insect Technique Programs

Mastrangelo, Thiago de Araujo
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 26/03/2009 Português
Relevância na Pesquisa
O recente medo de atos terroristas provocou um aumento do número de atrasos e cancelamentos do transporte de radioisótopos. Isto representa uma verdadeira ameaça aos projetos de produção de insetos estéreis ao redor do mundo. Visando validar o uso de um novo tipo de irradiador de raios-X de baixa energia, foram conduzidos uma série de estudos de radiobiologia para moscamed, Ceratitis capitata (linhagem tsl-VIENNA 8) (Wied., 1824) (Diptera: Tephritidae), e uma linhagem argentina de Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae), também calculando-se a eficiência biológica relativa (RBE) entre raios-X e a tradicional radiação de 60Co. Pupas 48-24 h antes da emergência do adulto de machos de moscamed e de ambos os sexos de A. fraterculus foram irradiadas com doses variando de 15 a 120 Gy e 10 a 70 Gy respectivamente. As doses que induzem 50, 90 e 99% de esterilidade foram estimadas e a hipótese de paralelismo para as equações de Probit foram testadas. Doses de 82,7 Gy de raios-X e 128,2 Gy de raios (portanto, uma RBE=1,5) induziram 99% de esterilidade em machos de moscamed. A fertilidade de fêmeas férteis de A. fraterculus cruzadas com machos irradiados com 41 Gy de raios-X e 62,7 Gy de raios foi reduzida em 99% comparando-se com a testemunha (RBE=1...

Análise de espécies crípticas do complexo Anastrepha fraterculus (Díptera: Tephritidae) no Brasil através de sequências do gene mitocondrial cytochrome oxidase I; Analyses of the Anastrepha fraterculus complex (Diptera: Tephritidae) in Brazil based on mitochondrial cytochrome oxidase I sequences

Araujo, Natália de Souza
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 07/08/2012 Português
Relevância na Pesquisa
A família Tephritidae congrega várias espécies de moscas-das-frutas que utilizam frutos como substrato alimentar no estágio larval, adquirindo o status de inseto-praga quando esses frutos são de valor comercial. O gênero Anastrepha é endêmico do Continente Americano e compreende cerca de 212 espécies descritas, das quais 109 ocorrem no Brasil. A espécie nominal Anastrepha fraterculus representa um complexo de espécies crípticas e se encontra distribuída pela Região Neotropical e sul dos Estados Unidos. No Brasil, através do estudo de diversas características biológicas e do marcador molecular ITS-1 (espaçador ribossômico nuclear), identificou-se a existência de três espécies crípticas no complexo fraterculus, a Anastrepha sp.1 affinis fraterculus, A. sp.2 aff. fraterculus e A. sp.3 aff. fraterculus. Marcadores gênicos presentes no DNA mitocondrial, como o gene cytochrome oxidase I (COI), são ferramentas amplamente utilizadas em análises filogenéticas, pois esta molécula apresenta características distintas do DNA nuclear, como o fato de possuir herança predominantemente materna, apresentar ausência ou baixíssima taxa de recombinação na maioria dos táxons, além de altas taxas mutacionais. Estas características possibilitam a obtenção de dados importantes na interpretação das relações entre as espécies. Amostras do complexo fraterculus (A. sp.1...

Tipificação de linhagens de Wolbachia do complexo Anastrepha fraterculus (Diptera: Tephritidae) da região neotropical por análise de locos múltiplos; Typification of Wolbachia's strains in the complex Anastrepha fraterculus (Diptera: Tephritidae) from the Neotropical Region by analysis of multiple loci

Prezotto, Leandro Fontes
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 10/04/2013 Português
Relevância na Pesquisa
Wolbachia é uma bactéria intracelular encontrada tanto nos tecidos somáticos quanto nos reprodutivos de diversas espécies de artrópodes e nematódeos. Estudos filogenéticos baseados nos genes 16S e ftsZ indicaram que o gênero Wolbachia congrega seis supergrupos taxonômicos ("A" a "F"). Infecções por Wolbachia têm sido associadas a diversas alterações na reprodução de seus hospedeiros, p. exemplo, a incompatibilidade citoplasmática (IC), partenogênese, feminização de machos genéticos e morte dos machos. A identificação das diferentes cepas da bactéria é mais precisa quando a análise por locos múltiplos (MLST) é aplicada. Infecção por Wolbachia foi descrita em diversas espécies de moscas-das-frutas da familia Tephritidae, Bactrocera ascita, Rhagoletis cerasi, Ceratitis capitata, nas quais a bactéria induz a incompatibilidade citoplasmática. No gênero Anastrepha, endêmico do Continente Americano, infecção por Wolbachia foi descrita em várias espécies pela análise do gene wsp, existindo também a indicação de que IC mediada por Wolbachia ocorra em duas espécies do grupo fraterculus. A ocorrência de IC aliada à sugestão do emprego da Wolbachia em programas de controle populacional das moscas-das-frutas...

Padrões de atividade da ornitina decarboxilase (ODC) e sua regulação hormonal sob estresse de temperatura em Anastrepha fraterculus (Diptera, Tephritidae)

Casali, Valesca Veiga Cardoso
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Tese de Doutorado Formato: application/pdf
Relevância na Pesquisa
Ornitina decarboxilase (ODC) (EC é a primeira enzima que desencadeia a síntese das poliaminas putrescina, espermidina e espermina nas células. As poliaminas são cátions alifáticos envolvidos no controle de crescimento e são requeridas para uma variedade de eventos biológicos como síntese de proteína, replicação do DNA e divisão celular. No presente estudo, a atividade da ODC foi medida em ovo, larva, pupa, fêmea jovem e adulta de Anastrepha fraterculus. Durante o desenvolvimento de A. fraterculus, a atividade da ODC apresentou flutuações. Entre os estágios anteriores à emergência, o ovo teve a mais alta atividade específica, provavelmente devido à embriogênese que é caracterizada pela alta taxa de divisão celular. A atividade da ODC foi também altamente significativa em ovários e corpo gorduroso de fêmeas jovens possivelmente devido ao avanço da oogênese e vitelogênese. Parâmetros cinéticos (Km app e Vmax) para atividade da ODC foram determinados em pupa, larva e ovário de fêmeas jovens e apresentaram grande variação. A guanosina trifosfato (GTP) demonstrou afetar grandemente estes parâmetros cinéticos, sugerindo estarem ocorrendo modificações pós-traducionais. Fêmeas jovens (4 dias) de A. fraterculus também foram analisadas quanto ao efeito do estresse de temperatura (6ºC e 20/6ºC) e da aplicação tópica do hormônio juvenil isolados ou em conjunto. . Os principais resultados foram que a concentração de 500 ng e os tempos de incubação de 3...

Effect of αlpha-difluormethylornithine on Anastrepha fraterculus (Diptera, Tephritidae) ovary size; Efeito da alfa-difluorometilornitina nas dimensões dos ovários em Anastrepha fraterculus (Diptera, Tephritidae)

Casali, Valesca Veiga Cardoso; Moreira, Jose Claudio Fonseca; Oliveira, Alice Kalisz de
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Artigo de Revista Científica Formato: application/pdf
Relevância na Pesquisa
As dimensões dos ovários (comprimento e largura) foram mensuradas em fêmeas jovens da Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) submetidas ou não ao inibidor α-difluormetilornitina (α-DFMO). A concentração mais efetiva de α-DMFO utilizada foi 50 mM e as medidas (comprimento e largura) das fêmeas tratadas com o inibidor foram menores que as fêmeas não tratadas com inibidor α-DMFO. Estes dados podem sugerir uma relação entre ornitina descarboxilase (ODC) e maturação sexual em A. fraterculus.; Ovarian sizes (length and width) were measured in young females of Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) subjected or not to the inhibitor α-difluormethylornithine (α-DFMO). The most effective concentration of α-DMFO used was 50 mM and the ovarian measurements (length and width) of the treated females were smaller than those of females not treated with α-DMFO. These data may suggest some relationship between ornithine decarboxylase (ODC) and sexual maturation in A. fraterculus.

Criação de Anastrepha fraterculus (Wied.)(Diptera: Tephritidae) em dieta artificial e avaliação de produtos fitossanitários utilizados no sistema orgânico de produção sobre esta espécie e insetos benéficos; Rearing Anastrepha fraterculus (Wied.)(Diptera: Tephritidae) in artificial diet and evaluation of phytosanitary products used in the organic system of production on this specie and beneficial insects

Efrom, Caio Fabio Stoffel
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Tese de Doutorado Formato: application/pdf
Relevância na Pesquisa
A mosca-das-frutas sul-americana, Anastrepha fraterculus (Wied.) é um dos principais problemas à produção de frutíferas no Brasil. No sistema orgânico de produção, há diversas alternativas para o controle das moscas-das-frutas, como óleos, extratos de plantas e caldas. Entretanto, para a maioria dessas substâncias, não há a comprovação científica, quanto à eficiência de controle e seletividade a insetos benéficos. Experimentos que avaliam a ação inseticida de agrotóxicos demandam grande número de indivíduos produzidos de forma padronizada. No Brasil, não há, para A. fraterculus, uma metodologia de criação eficiente que atenda esta demanda. Assim, os objetivos deste trabalho foram: desenvolver uma metodologia para criação de A. fraterculus em dieta atificial e avaliar os produtos fitossanitários utilizados no sistema orgânico sobre A. fraterculus e os insetos benéficos, Apis mellifera L. (Hymenoptera; Apidae) e Cryptolaemus montrouzieri Mulsant (Coleoptera; Coccinellidae), em condições de laboratório. Para isso, se utilizou quatro múltiplos (0,25x, 0,5x, 1x e 2x) da dose recomendada pelos fabricantes dos produtos Rotenat CE® (600mL 100L-1), Pironat® (250mL 100L-1), Biopirol 7M® (200mL 100L-1)...

Wolbachia endosymbiont in a species of the Anastrepha fraterculus complex (Diptera: Tephritidae)

Selivon, Denise; Perondini, André Luiz P.; Ribeiro, Alberto F.; Marino, Celso L.; Lima, Marleide M.A.; Coscrato, Virginia E.
Fonte: Universidade Estadual Paulista Publicador: Universidade Estadual Paulista
Tipo: Artigo de Revista Científica Formato: 121-127
Relevância na Pesquisa
In Anastrepha sp.2 aff. fraterculus, the egg-cell harbours a large population of endosymbionts. The bacteria were identified as belonging to genus Wolbachia by PCR assay using primers of the ftsZ gene followed by sequencing of the amplified band. Newly deposited eggs stained in toto by Hoechst show that the bacteria are unevenly dispersed throughout the egg-cell, with a higher accumulation at the posterior pole, and that the degree of infestation varies from egg to egg. Analysis by transmission electron microscopy shows that bacteria are present in the female germ line of embryonic and larval stages, as well as in the different cell types of the ovaries at the adult stage. Mature ova within the follicles harbour a large population of the symbionts. The results indicate the existence of a transovarian transmission of the endosymbionts in this fly.

Flutuação populacional de Anastrepha fraterculus (Wiedemann) e Ceratitis capitata (Wiedemann) (Diptera, Tephritidae) em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul

Garcia,Flávio Roberto Mello; Corseuil,Elio
Fonte: Sociedade Brasileira de Zoologia Publicador: Sociedade Brasileira de Zoologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/1998 Português
Relevância na Pesquisa
This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824) and Ceratitis capitata (Wiedemann, 1830) in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae)

Destéfano,Ricardo Henry Rodrigues; Bechara,Ivanira José; Messias,Claudio Luiz; Piedrabuena,Aquiles Eugênico
Fonte: Sociedade Brasileira de Microbiologia Publicador: Sociedade Brasileira de Microbiologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/03/2005 Português
Relevância na Pesquisa
The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales) strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae), against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS) and non-autoclaved (NAS) soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10) for AS and 2.52 x 10(10) for NAS. The lethal concentration (LC50), expressed as conidia concentration, was 8.44 x 10(9) conidia/g of soil (S) for AS and 12.23 x 10(9) conidia/g of soil for NAS.

Effect of α-difluormethylornithine on Anastrepha fraterculus (Diptera, Tephritidae) ovary size

Cardoso,VV.; Moreira,JCF.; Oliveira,AK.
Fonte: Instituto Internacional de Ecologia Publicador: Instituto Internacional de Ecologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/02/2009 Português
Relevância na Pesquisa
Ovarian sizes (length and width) were measured in young females of Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) subjected or not to the inhibitor α -difluormethylornithine (α -DFMO). The most effective concentration of α -DMFO used was 50 mM and the ovarian measurements (length and width) of the treated females were smaller than those of females not treated with α -DMFO. These data may suggest some relationship between ornithine decarboxylase (ODC) and sexual maturation in A. fraterculus.

Pheromone Analyses of the Anastrepha fraterculus (Diptera: Tephritidae) Cryptic Species Complex

Fonte: Florida Entomologist, v. 96, n. 3, p. 1107-1115, 2013. Publicador: Florida Entomologist, v. 96, n. 3, p. 1107-1115, 2013.
Tipo: Artigo em periódico indexado (ALICE)
Relevância na Pesquisa
The South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) cryptic species complex is presently one of the most studied pest models in terms of speciation and population mating compatibility. The improvement of pest-control techniques has strongly relied on successful implementation of laboratory strains into wild populations. Pheromone communication plays an important role in the mating process in the South American fruit fly. Therefore, the main goal of the present study was to investigate the pheromone composition of 7 different populations, originating from geographically distant locations in Brazil and Argentina. Fourteen volatile compounds were identified in calling male emanations by GC×GC/TOF-MS and the data obtained were subsequently analyzed by multivariate statistics. The pheromone composition varied both quantitatively and qualitatively among the studied populations. These results will serve as the basis for further electrophysiological analyses; 2013

Avaliação da atividade sexual pré-zigótica de populações de Anastrepha fraterculus (Wiedmann, 1830) (Diptera: Tephritidae).

Fonte: In: ENCONTRO DE INICIAÇÃO CIENTÍFICA DA EMBRAPA UVA E VINHO, 12., ENCONTRO DE PÓS-GRADUANDOS DA EMBRAPA UVA E VINHO, 8., 2014, Bento Gonçalves. Resumos... Bento Gonçalves: Embrapa Uva e Vinho, 2014. Publicador: In: ENCONTRO DE INICIAÇÃO CIENTÍFICA DA EMBRAPA UVA E VINHO, 12., ENCONTRO DE PÓS-GRADUANDOS DA EMBRAPA UVA E VINHO, 8., 2014, Bento Gonçalves. Resumos... Bento Gonçalves: Embrapa Uva e Vinho, 2014.
Tipo: Resumo em anais de congresso (ALICE) Formato: p. 24
Relevância na Pesquisa
Neste trabalho foi avaliada a competitividade sexual pré-zigótica das populações de A. fraterculus: 1) selvagem; 2) laboratório (78° geração) e 3) laboratório esterilizadas.; 2014

Espaço agrícola, ambiente e agroecologia: incidência de moscas-das-frutas (Diptera, Tephritidae) nos pomares de laranjado munícipio de Caraá, RS; Pace agricultural, atmosphere and agroecologia : incidence of fly-give-fruits (Diptera, Tephritidae) in the orchard of orange of the Caraá, RS

Fofonka, Luciana
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Dissertação Formato: application/pdf
Relevância na Pesquisa
O Brasil é o maior produtor de laranjas do mundo, porém os problemas fitossanitários, como a incidência da mosca-das-frutas, vêm acarretando sérios impactos negativos de ordem sócio-econômica e ambiental. O município de Caraá, RS, está nos perímetros das regiões infestadas pela mosca-das-frutas, sendo a cultura da laranja a mais prejudicada por esse inseto. Para que o manejo da moscas-das-frutas seja eficiente e sustentável é interessante que o mesmo se baseie nos princípios da Agroecologia, requerendo um conhecimento prévio de vários aspectos que possibilitem o diagnóstico dessa praga. Nesse contexto, o presente estudo teve por objetivo contribuir para o controle da mosca-das-frutas nos pomares de laranjeiras do município de Caraá, RS. Para tanto, o trabalho foi dividido em duas grandes etapas. Na primeira etapa realizou-se o diagnóstico da incidência da mosca-dasfrutas nos pomares de laranjeiras do município de Caraá através da caracterização da área de estudo, da cultura da laranjeira e da incidência da mosca-das-frutas, demonstrando a espacialização das principais localidades produtoras de laranja. Utilizaram-se como fontes de pesquisa, bibliografias e entrevistas. Para a segunda etapa foi elaborado e aplicado na área de estudo um Plano de Manejo da mosca-das-frutas baseado na Agroecologia...

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

Bechara,IJ.; Destéfano,RHR.; Bresil,C.; Messias,CL.
Fonte: Instituto Internacional de Ecologia Publicador: Instituto Internacional de Ecologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/02/2011 Português
Relevância na Pesquisa
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process...

Las poblaciones argentinas de Anastrepha fraterculus (Diptera: tephritidae) conforman una única especie biológica?; Do argentinean population of Anastrepha fraterculus (Diptera: tephritidae)contitute a single biological species?

Alberti, Andrea Claudia
Fonte: Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires Publicador: Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires
Tipo: info:eu-repo/semantics/doctoralThesis; tesis doctoral; info:eu-repo/semantics/publishedVersion Formato: application/pdf
Publicado em //2004 Português
Relevância na Pesquisa
La Mosca Sudamericana de la Fruta, Anastrepha jiaterculus (Wiedmann), díptero perteneciente a la familia Tephritidae, es una importante plaga de árboles frutales, silvestres y cultivados, que provoca un gran daño económico a lo largo de su extensa distribución geográfica en el continente americano. En esta tesis se estudiaron poblaciones naturales de esta mosca en diferentes localidades de la República Argentina y en una localidad del sur del Brasil, por medio de distintas metodologías (Electroforesis de Isoenzimas, PCR + RFLP y Secuenciación). El objetivo fue analizar la estructura y la variación genética en dichas poblaciones a fin de poner a prueba la "Hipótesis del Complejo de Especies Crípticas" propuesta por varios autores. Las diferentes metodologías aplicadas evidenciaron una variabilidad compatible con la esperada para poblaciones de una misma especie, sin una estructuración genética asociada a la distribución geográfica. Por lo tanto los argumentos expuestos en este trabajo sugieren que las poblaciones de nuestro país constituyen una única especie biológica; Fill:Alberti, Andrea Claudia. Universidad deBuenos Aires. Facultad de Ciencias Exactas y Naturales;Argentina.

Las poblaciones argentinas de Anastrepha fraterculus (Diptera: tephritidae) conforman una única especie biológica?; Do argentinean population of Anastrepha fraterculus (Diptera: tephritidae)contitute a single biological species?

Alberti, Andrea Claudia
Fonte: Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires Publicador: Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires
Tipo: Tesis Doctoral Formato: text; pdf
Publicado em //2004 Português
Relevância na Pesquisa
La Mosca Sudamericana de la Fruta, Anastrepha jiaterculus (Wiedmann), díptero perteneciente a la familia Tephritidae, es una importante plaga de árboles frutales, silvestres y cultivados, que provoca un gran daño económico a lo largo de su extensa distribución geográfica en el continente americano. En esta tesis se estudiaron poblaciones naturales de esta mosca en diferentes localidades de la República Argentina y en una localidad del sur del Brasil, por medio de distintas metodologías (Electroforesis de Isoenzimas, PCR + RFLP y Secuenciación). El objetivo fue analizar la estructura y la variación genética en dichas poblaciones a fin de poner a prueba la "Hipótesis del Complejo de Especies Crípticas" propuesta por varios autores. Las diferentes metodologías aplicadas evidenciaron una variabilidad compatible con la esperada para poblaciones de una misma especie, sin una estructuración genética asociada a la distribución geográfica. Por lo tanto los argumentos expuestos en este trabajo sugieren que las poblaciones de nuestro país constituyen una única especie biológica

Effect of insecticides on Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) in 'Italy' table grape under plastic cover

Ruben,Machota Junior¹; Formolo,Rodrigo; Bernardi,Daniel; Botton,Marcos; Rufato,Leo
Fonte: Facultad de Ciencias Agrarias, UNA. Publicador: Facultad de Ciencias Agrarias, UNA.
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/12/2013 Português
Relevância na Pesquisa
A mosca-das-frutas sul-americana Anastrepha fraterculus (Wied.) é o principal inseto-praga que danifica as bagas de uvas de mesa (Vitis vinifera L.) na Região Sul do Brasil. Extratos de plantas com propriedades inseticidas são alternativas para o manejo da espécie na cultura, porém, poucas informações estão disponíveis sobre a eficácia dos compostos ofertados no mercado. Neste trabalho, foi avaliado o efeito de uma formulação comercial de inseticida a base de rotenona e nim (RN) sobre adultos e larvas de A. fraterculus em laboratório e campo, comparado ao inseticida fentiona e uma testemunha (água destilada). Em laboratório, o inseticida RN a base de rotenona e nim foi equivalente a fentiona quando os adultos de A. fraterculus foram expostos via contato e ingestão por 72 horas. No entanto, o inseticida não apresentou efeito (mortalidade de 20%) sobre larvas de A. fraterculus no interior de bagas de uva da cv. ‘Itália’ quando comparado com o inseticida fentiona (100% de mortalidade). Em vinhedo comercial, o inseticida RN a base de rotenona e nim proporcionou um controle de aproximadamente 40%, sen­do inferior a fentiona (100% de controle). Os dois inseticidas não impediram a oviposição de A. fraterculus nas bagas. Conclui-se que...