Página 1 dos resultados de 1560 itens digitais encontrados em 0.006 segundos

Effect of olive fruit fly infestation on the quality of olive oil from cultivars cobrançosa, madural and verdeal transmontana

Pereira, J.A.; Alves, M.R.; Casal, Susana; Oliveira, M.B.P.P.
Fonte: Chiriotti Editori Publicador: Chiriotti Editori
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
56.51%
Olives (Olea europaea L.) from cultivars Cobrançosa, Madural and Verdeal Transmontana were collected separately and divided into two different groups according to the presence or absence of infestation by the olive fruit fly (Bactrocera oleae Gmel.). These two groups were then mixed in varying percentages to create five groups of olives per cultivar with infestation levels: 0, 12.5, 25, 50 and 100%. Each group was then processed to produce olive oil. The results, regarding mainly acidity, peroxide value, and stability to oxidation, suggest that olive fruit fly infestation reduces the quality of the olive oil. The effects of infestation varied according to cultivar, but in general the total tocopherol content was always lower at the 100% infestation level. The oil from cultivar Verdeal Transmontana had the lowest tocopherol content compared to oil from cultivars Cobrançosa and Madural, which could explain the lower quality of its oil.

Effect of different attractants used in Olipe traps for olive fly mass-trapping on parasitoids in the Northeast of Portugal.

Porcel, M.; Bento, Albino; Campos, M.; Pereira, J.A.
Fonte: Instituto Politécnico de Bragança Publicador: Instituto Politécnico de Bragança
Tipo: Conferência ou Objeto de Conferência
Português
Relevância na Pesquisa
56.37%
The hymenoptera parasitoids represent and important beneficial group in olive agroecosystem. Their action maintains certain olive pest species numbers lower than the economic threshold. In this can text, to improve their activity and increase the sustainability of the olive agroecosystem it is necessary to know the negative effect of different agronomic practices in their populations. In ecological production, mass-trapping is an important control method against the olive fruit fly, Bactrocera oleae Gmel., the most serious pest of olives in the Mediterranean countries. The aim of the present work was to study the effect on parasitoids of different attractants used combined with Olipe traps.

Role of edaphic arthropods on the biological control of the olive fruit fly (Bactrocera oleae)

Dinis, Ana Maria de Sousa Pereira
Fonte: Instituto Politécnico de Bragança Publicador: Instituto Politécnico de Bragança
Tipo: Dissertação de Mestrado
Português
Relevância na Pesquisa
46.89%
The olive fruit fly, Bactrocera oleae (Rossi) is a major pest of the olive tree. A great part of its life cycle is spent inside the olive fruit, which hinders the action of natural enemies. However, pupation usually occurs on the ground, which makes this stage more vulnerable to predation by edaphic arthropods. In this context, with the present work, it was studied the role of the edaphic arthropods on the biological control of olive fruit fly. Under laboratory conditions, Calathus granatensis Vuillefroy and Pterostichus globosus Quensel, two species of carabids abundant in groves of Trás-os-Montes were evaluated as potential predators of olive fruit fly. The food preferences of both carabids were studied as olive fruit fly pupae were offered together with pupae of the Mediterranean fruit fly (Ceratitis capitata Wiedemann) in different proportions. It was also evaluated the functional responses of both carabids on different densities of olive fruit fly pupae. Under field conditions predation by edaphic arthropods on olive fruit fly pupae was evaluated using exposed-exclusion boxes to predators along with pitfall traps for capture of the arthropods active near the boxes. The assay was conducted in two olive groves of the region of Mirandela (northeast of Portugal) between January and May. Biological control provided by edaphic arthropods was measured by calculating biological control services indexes that were further correlated with the abundance of arthropods and functional groups captured in the pitfall traps. The results of the laboratory experiments indicate that both species of carabids studied preyed olive fruit fly pupae...

Infestação de moscas-das-frutas (Diptera: Tephritidae e Lonchaeidae) relacionada à fenologia da goiabeira (Psidium guajava L.), nespereira (Eriobotrya japonica Lindl.) e do pessegueiro (Prunus persica Batsch); Correlating the infestation of fruit flies (Diptera: Tephritidae and Loncheidae) to the guava, peach and loquat trees phenology

Souza Filho, Miguel Francisco de
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 17/03/2006 Português
Relevância na Pesquisa
56.76%
Os experimentos de campo foram realizados em 2002 e 2003 em três pomares no município de Monte Alegre do Sul, SP, representados por uma coleção de linhagens de goiabeiras (janeiro a abril), uma coleção de cultivares de nespereiras (agosto a setembro) e uma coleção de cultivares de pessegueiros (setembro a outubro). Nos ensaios de infestação, foram utilizadas três linhagens de goiaba (Guanabara, L7P28 e 252), duas cultivares de nêspera (Precoce Campinas e a Precoce 264-54) e três cultivares de pêssego (Aurora 2, Dourado 1 e Régis). Para a determinação do período de infestação, aplicou-se o processo de ensacamento e desensacamento quinzenal e semanal da goiaba e nêspera, respectivamente, e apenas o ensacamento semanal no pêssego. Cada experimento iniciou-se com os frutos ainda no início de seu desenvolvimento (frutos verdes). Para o processo de desensacamento, no início dos experimentos foram ensacados 500 e 400 frutos de goiaba e nêspera, respectivamente. Em cada ensaio, desde o início (frutos verdes pequenos) até a completa maturação, quinzenalmente (goiaba) ou semanalmente (nêspera e pêssego) foi ensacada/desensacada uma amostra de 30 frutos, os comprimentos e diâmetro eram mensurados e retirava-se amostras para realização das análises físico-químicas em laboratório. Após o completo amadurecimento...

Comportamento olfativo de três espécies de parasitóides (Hymenoptera: Braconidae) de moscas-das-frutas (Diptera: Tephritidae); Olfactory behavior of three parasitoid species (hymenoptera: braconidae) of fruit flies (diptera: tephritidae)

Silva, José Wilson Pereira da
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 22/07/2005 Português
Relevância na Pesquisa
56.6%
Entre os inimigos naturais das moscas-das-frutas, os representantes da subfamília Opiinae (Hymenoptera: Braconidae) têm sido os mais utilizados em programas de controle biológico. Entretanto, algumas espécies da subfamília Alysiinae são comumente relacionadas ao parasitismo desses dípteros, em particular Asobara anastrephae (Muesebeck). No estudo da eficiência desses parasitóides é de fundamental importância o conhecimento dos estímulos utilizados para a localização do hábitat de seus hospedeiros. Dessa forma, foram avaliadas as respostas olfativas do parasitóide exótico Diachasmimorpha longicaudata Ashmead, e dos nativos, Doryctobracon areolatus (Szépligeti) e A. anastrephae a frutos de goiaba (Psidium guajava L.) com e sem larvas de moscasdas- frutas, em condições de laboratório. D. longicaudata e D. areolatus foram também estudados em telado. As fêmeas de D. longicaudata e de D. areolatus responderam aos odores de frutos podres não-infestados, embora D. areolatus também tenha sido atraído aos frutos em maturação inicial (de vez). As fêmeas dessas espécies demonstraram reconhecer os voláteis de frutos com larvas de Ceratitis capitata (Wied.). No entanto, em bioensaios realizados com frutos contendo larvas de diferentes instares...

Produção em grande escala do parasitoide Diachasmimorpha longicaudata (Hymenoptera: Braconidae) em larvas hospedeiras de Anastrepha fraterculus e Ceratitis capitata (Diptera: Tephritidae) linhagem mutante tsl-V; Large-scale production of the fruit fly parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) using Anastrepha fraterculus and Ceratitis capitata (Diptera: Tephritidae) tsl-Vienna 8 strain as hosts

Andrade, Renata Morelli de
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 05/06/2013 Português
Relevância na Pesquisa
56.42%
No mundo todo, o manejo integrado de moscas-das-frutas é feito com associação do controle biológico aplicado e técnica do inseto estéril. Além da boa eficiência no campo, a associação dessas técnicas é também favorecida pelo fato de ambos os organismos, insetos estéreis e parasitoides, poderem ser produzidos massalmente na mesma fábrica com menor custo. Visando à produção massal do parasitoide de moscas-das-frutas Diachasmimorpha longicaudata e de insetos estéreis para atender a programas de manejo integrado de Ceratitis capitata e Anastrepha fraterculus, o presente trabalho foi desenvolvido no Centro de Energia Nuclear na Agricultura (CENA), da Universidade de São Paulo, entre os anos de 2006 a 2012. Durante esse período, metodologias de criação em laboratório foram implementadas e permitiram o desenvolvimento da tecnologia necessária para a produção desses insetos em grande escala no Brasil. Dados de 25 gerações do parasitoide produzido em grande escala em C. capitata tsl-Viena 8 e 51 gerações em A. fraterculus, bem como os efeitos e diferenças desses hospedeiros na qualidade do parasitoide foram analisados. É possível criar o parasitoide D. longicaudata em ambos os hospedeiros, C. capitata linhagem tsl-Viena 8 e A. fraterculus...

Faunal analysis of the species Anastrepha in the fruit growing complex Gaviao River, Bahia, Brazil

de Sa, Ricardo Falcao; Castellani, Maria Aparecida; Lopes Ribeiro, Ana Elizabete; Perez-Maluf, Raquel; Moreira, Aldenise Alves; Nagamoto, Nilson Satoru; do Nascimento, Antonio Souza
Fonte: Alma Mater Studiorum, Univ Bologna Publicador: Alma Mater Studiorum, Univ Bologna
Tipo: Artigo de Revista Científica Formato: 37-42
Português
Relevância na Pesquisa
56.53%
Besides being considered the greatest pests of fruit growing, fruit flies constitute a large obstacle to the growth of the exportation of fresh fruit. Knowledge of the structure of fruit fly communities is of great importance to the bioecological studies of these insects, but there is a lack of information about the faunistic composition of fruit flies in Brazil. The objective of this work was to analysis the composition of the species of Anastrepha, in eleven mango orchards of the fruit growing complex Gaviao River, Bahia, Brazil. These studies were done in 2004 and 2005, in Anage, Caraibas and Belo Campo town, 23 McPhail traps, which collected 798 female fruit flies from the genus Anastrepha. The structure of these communities was evaluated in each orchard by means of faunistic indexes frequency, constancy, dominance, diversity and similarity. The number of species varied from four to eight in each orchard; and the following species was recorded: Anastrepha fraterculus (Wiedemann), Anastrepha obliqua (Macquart), Anastrepha dissimilis Stone, Anastrepha amita Zucchi, Anastrepha distincta Greene, Anastrepha pickeli Lima. Anastrepha sororcula Zucchi and Anastrepha zenildae Zucchi. The most frequent and dominant species were A. fraterculus and A. obliqua. The indexes of diversity varied from 1.01 to 1.62. In general...

Fruit flies (Diptera, Tephritidae) and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

Taira,Tiago Ledesma; Abot,Alfredo Raúl; Nicácio,José; Uchôa,Manoel Araécio; Rodrigues,Sérgio Roberto; Guimarães,Jorge Anderson
Fonte: Sociedade Brasileira De Entomologia Publicador: Sociedade Brasileira De Entomologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/09/2013 Português
Relevância na Pesquisa
56.63%
Fruit flies (Diptera, Tephritidae) and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart.) Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw.) Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping), nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae), and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered...

First survey of fruit fly (Diptera: Tephritidae) and parasitoid diversity among myrtaceae fruit across the state of Bahia, Brazil

Silva,Lidia Nogueira; Santos,Mírian Silva; Dutra,Vivian Siqueira; Araujo,Elton Lucio; Costa,Marco Antonio; Silva,Janisete Gomes
Fonte: Sociedade Brasileira de Fruticultura Publicador: Sociedade Brasileira de Fruticultura
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/09/2011 Português
Relevância na Pesquisa
56.74%
The objective of this study was to evaluate the diversity of fruit fly (Diptera: Tephritidae) species that use myrtaceous fruit, particularly guava, as hosts in several localities in the state of Bahia and to determine the infestation rates, pupal viability rates, and fruit fly-parasitoid associations. Sampling of myrtaceous fruit was carried out in 24 municipalities in different regions in the state of Bahia. Four fruit fly species, Anastrepha fraterculus, Anastrepha zenildae, Anastrepha sororcula, and Ceratitis capitata were obtained from the collected fruit. Three parasitoid species (Hymenoptera: Braconidae) emerged from Anastrepha larvae/pupae, Doryctobracon areolatus, Utetes anastrephae, and Asobara anastrephae. Doryctobracon areolatus emerged from A. fraterculus, A. sororcula and A. zenildae; Utetes anastrephae emerged from A. fraterculus and A. zenildae; and Asobara anastrephae emerged from A. fraterculus. Fruit fly and myrtaceous fruit associations are reported for the first time in several municipalities in the state of Bahia. A. zenildae was found infesting Syzygium malaccense for the first time in Brazil.

Karyotype of the gall fly Tomoplagia rudolphi (Lutz & Lima) (Diptera, Tephritidae)

Carneiro,Marco Antônio A.; Gomes,Luiz Fernando; Pompolo,Silvia das Graças; Campos,Lucio Antonio de Oliveira
Fonte: Sociedade Brasileira de Zoologia Publicador: Sociedade Brasileira de Zoologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/1999 Português
Relevância na Pesquisa
56.43%
The objective of the present study is to describe the karyotype of the fruit fly Tomoplagia rudolphi (Lutz & Lima, 1918). This fly induces the formation of galls on the stems of Vernonia polianthes (Asteraceae). The cytogenetic analysis of cerebral ganglia (larva and pupa) and testis (adults) of T. rudolphi showed a diploid chromosome number of 2n = 10 + xx (female) and 2n = 10 + xy (male). The diploid chromosome number 2n = 12 and the XX/XY sex determination system have been found in most of the species studied. The present investigation constitutes the first cytogenetics study of the genus Tomoplagia Coquilltt, 1910.

Host plants of the carambola fruit fly, Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), in Suriname, South America

Sauers-Muller,Alies van
Fonte: Sociedade Entomológica do Brasil Publicador: Sociedade Entomológica do Brasil
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/04/2005 Português
Relevância na Pesquisa
56.68%
Fruits were collected over a 12-year period to determine the host status for the Carambola fruit fly, Bactrocera carambolae Drew & Hancock, and other tephritid species in Suriname, South America. Over 11,000 fruit samples were collected from many locations and the total of 20 fruit species were recorded as host, ranging in infestation from heavy to occasional. Over 650 samples of 188 fruit species, including many wild species, were collected and no fruit flies were reared. This work, which started specifically to obtain information on the Carambola fruit fly, resulted also in detailed information regarding the importance, distribution and host preferences of several Anastrepha species, and the status of fruit fly parasitoids.

Hot-Water Quarantine Treatment for Mangoes from Mexico Infested with Mexican Fruit Fly and West Indian Fruit Fly (Diptera: Tephritidae)

Sharp, Jennifer L.; Ouye, Milton T.; Ingle, Sammy J.; Hart, William G.
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica Formato: text/html
Português
Relevância na Pesquisa
66.65%
Heated water was used in the development of a quarantine treatment to kill Mexican fruit fly, Anastrepha ludens (Loew), and West Indian fruit fly, A. oblique (Macquart) infestations in mango, Mangifera indica L. Mangoes from Mexico were infested in the laboratory and immersed in water at 46.1°C for 10-70 min to estimate time-mortality relationships. Probit analysis of the data estimated the immersion time needed to reach Probit 9 security for a laboratory strain of A. ludens as 65.1 min for mixed cultivars (‘Haden,’ ‘Tommy Atkins,’ ‘Keitt,’ and ‘Kent’). For a feral strain (wild) in ‘Haden,’ the estimated immersion time was 71.4 min. The estimated immersion times for Probit 9 security for A. obliqua in ‘Kent’ were 66.8 min for a laboratory strain and 83.6 min for a wild strain. A large-scale test resulted in no survivors based on number of normal pupae when 187,114 A. ludens (laboratory) in 4,864 ‘Keitt’ and ‘Oro’; 226,054 A. ludens (wild) in 5,530 ‘Haden’ and ‘Tommy Atkins’; 116,869 A. obliqua (wild) in 7,703 ‘Kent’; and 101,049 A. obliqua (laboratory) in 8,775 ‘Keitt,’ ‘Haden,’ and ‘Tommy Atkins’ were immersed in water at 46...

Hot-Water Quarantine Treatment for Mangoes from the State of Chiapas, Mexico, Infested with Mediterranean Fruit Fly and Anastrepha serpentine (Wiedemann) (Diptera: Tephritidae)

Sharp, Jennifer L.; Ouye, Milton T.; Ingle, Sammy J.; Hart, William G.; Enkerlin, Walther R. H.; Celedonio, Hilario H.; Toledo, Jorge A.; Stevens, Lynn; Quintero, Elba; Reyes, Jesus F.; Schwarz, Arturo
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica Formato: text/html
Português
Relevância na Pesquisa
66.46%
Heated water was used in the development of a quarantine treatment to kill tephritid larval infestations in mango, Mangifera indica L., from the state of Chiapas, Mexico. Infested mangoes were immersed for 20-80 min in water at 45.9-47. 1°C for laboratory tests. Probit analysis of the data estimated immersion times needed to reach Probit 9 as 67.5 min for the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and 64.5 min for Anastrepha serpentine (Wiedemann). Confirmatory tests resulted in no survivors when 138,443 C. capitata larvae in 13,797 infested mangoes and 111,031 A. serpentine larvae in 12,089 infested mangoes were immersed in water at 45.9-47.1°C for 90 min. ‘Ataulfo’ mangoes immersed in water at 46.1°C for 90 min were not damaged; however, none were acceptable after 7 d at 23.9°c. Most mangoes (93.3%) were acceptable if immersed in water at 46. 1°C for 90 min and refrigerated at 11.1°C for 14 d, and 13.3% were acceptable after 7 d at 23-24°C. Only 10% were acceptable if immersed in water at 46.1°C for 90 min and refrigerated at 11.1°C for 21 d.

Response of Caribbean Fruit Fly (Diptera: Tephritidae) to Modified McPhail and Jackson Traps: Effects of Trapping Duration and Population Density

Mason, L. J.; Baranowski, R. M.
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica Formato: text/html
Português
Relevância na Pesquisa
66.46%
Relative capture of Caribbean fruit fly (Anastrepha suspense (Loew)) by modified McPhail and Jackson traps was examined under fall and spring population densities. The influence of trap duration (one week compared with several weeks) also was examined. Standard McPhail traps were superior to all other designs at spring population densities (low). At fall population densities (high), the standard McPhail, solid orange Jackson trap, and the “umbrella” McPhail were equally effective for female and total trap catch. There was no significant difference in male trap catch during the fall. Because there was significant weekly variation in trap catch, trap evaluations need to be done over long periods of time.

Thermal Death Kinetics of Mediterranean, Malaysian, Melon, and Oriental Fruit Fly (Diptera: Tephritidae) Eggs and Third Instars

Armstrong, John W.; Tang, Juming; Wang, Shaojin
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica Formato: text/html
Português
Relevância na Pesquisa
46.88%
The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50°C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs ≤ third instars at 44, 46, and 50°C, third instars ≤ eggs at 48°C, and wild third instars < the laboratory-reared third instars. Comparison between Mediterranean fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian...

Selection of entomopathogenic nematodes for the control of the fruit fly Ceratitis capitata (Diptera: Tephritidae); Seleção de nematoides entomopatogênicos visando ao controle da mosca das frutas Ceratitis capitata (Diptera: Tephritidae)

Fonte: Universidade Federal Rural de Pernambuco Publicador: Universidade Federal Rural de Pernambuco
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
66.51%
Entomopathogenic nematodes are considered excellent biological control agents, with greater potential against soil insect pests and pests of cryptic environments. The fruit fly Ceratitis capitata is considered one of the main fruit crop pests worldwide. This insect stays in the soil during a phase of life, where it becomes a target for entomopathogenic nematodes. The objective of this study was to evaluate the pathogenicity and virulence of entomopathogenic nematodes on C. capitata. The bioassays were organized with four replications, containing 10 individuals; 1 mL of a nematode suspension containing 200 IJ/insect was applied. The most virulent isolates against C. capitata larvae were selected and applied at concentrations of 0, 50, 100, 150, 200, 250, 300, 350 and 400 IJ/insect. All isolates were pathogenic for C. capitata. The S. carpocapsae ALL and Heterorhabditis sp. RSC01 isolates were the most virulent against the larval stage, with mortalities of over 85%. As to the pupal stage, isolates Heterorhabditis sp. PI, Heterorhabditis sp. JPM4, H. bacteriophora HP88, S. feltiae and S. glaseri were the best, with mortalities ranging between 35 and 44%.

Espaço agrícola, ambiente e agroecologia: incidência de moscas-das-frutas (Diptera, Tephritidae) nos pomares de laranjado munícipio de Caraá, RS; Pace agricultural, atmosphere and agroecologia : incidence of fly-give-fruits (Diptera, Tephritidae) in the orchard of orange of the Caraá, RS

Fofonka, Luciana
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Dissertação Formato: application/pdf
Português
Relevância na Pesquisa
56.81%
O Brasil é o maior produtor de laranjas do mundo, porém os problemas fitossanitários, como a incidência da mosca-das-frutas, vêm acarretando sérios impactos negativos de ordem sócio-econômica e ambiental. O município de Caraá, RS, está nos perímetros das regiões infestadas pela mosca-das-frutas, sendo a cultura da laranja a mais prejudicada por esse inseto. Para que o manejo da moscas-das-frutas seja eficiente e sustentável é interessante que o mesmo se baseie nos princípios da Agroecologia, requerendo um conhecimento prévio de vários aspectos que possibilitem o diagnóstico dessa praga. Nesse contexto, o presente estudo teve por objetivo contribuir para o controle da mosca-das-frutas nos pomares de laranjeiras do município de Caraá, RS. Para tanto, o trabalho foi dividido em duas grandes etapas. Na primeira etapa realizou-se o diagnóstico da incidência da mosca-dasfrutas nos pomares de laranjeiras do município de Caraá através da caracterização da área de estudo, da cultura da laranjeira e da incidência da mosca-das-frutas, demonstrando a espacialização das principais localidades produtoras de laranja. Utilizaram-se como fontes de pesquisa, bibliografias e entrevistas. Para a segunda etapa foi elaborado e aplicado na área de estudo um Plano de Manejo da mosca-das-frutas baseado na Agroecologia...

Assessment of Attractiveness of Plants as Roosting Sites for the Melon Fly, Bactrocera cucurbitae, and Oriental Fruit Fly, Bactrocera dorsalis

McQuate, Grant T.; Vargas, Roger I.
Fonte: University of Wisconsin Library Publicador: University of Wisconsin Library
Tipo: Artigo de Revista Científica
Publicado em 14/11/2007 Português
Relevância na Pesquisa
46.86%
The use of toxic protein bait sprays to suppress melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), populations typically involves application to vegetation bordering agricultural host areas where the adults seek shelter (“roost”). Although bait spray applications for suppression of oriental fruit fly, Bactrocera dorsalis (Hendel), populations have traditionally been applied to the host crop, rather than to crop borders, roosting by oriental fruit flies in borders of some crop species, such as papaya, Carica papaya L. (Brassicales: Caricaceae), suggests that bait spray applications to crop borders could also help in suppression of B. dorsalis populations. In order to develop improved recommendations for application of bait sprays to border plants for suppression of melon fly and oriental fruit fly populations, the relative attractiveness of a range of plant species, in a vegetative (non-flowering) stage, was tested to wild melon fly and oriental fruit fly populations established in a papaya orchard in Hawaii. A total of 20 plant species were evaluated, divided into four categories: 1) border plants, including corn, Zea mays L. (Poales: Poaceae), windbreaks and broad-leaved ornamentals, 7 species; 2) weed plants commonly found in agricultural fields in Hawaii...

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

Bechara,IJ.; Destéfano,RHR.; Bresil,C.; Messias,CL.
Fonte: Instituto Internacional de Ecologia Publicador: Instituto Internacional de Ecologia
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/02/2011 Português
Relevância na Pesquisa
66.46%
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process...

Controle da infestação natural de ceratitis capitata (Wied., 1824) (Diptera, Tephritidae) em pêssegos(Prunus persica) através das radiações gama; Control of naturally infested peaches (Prunus persica) by mediterranean fruit fly (Ceratitis capitata) through the use of gamma radiation

Arthur, V.; Caceres, C.; Wiendl, F.M.; Wiendl, J.A.
Fonte: Universidade de São Paulo. Escola Superior de Agricultura Luiz de Queiroz Publicador: Universidade de São Paulo. Escola Superior de Agricultura Luiz de Queiroz
Tipo: info:eu-repo/semantics/article; info:eu-repo/semantics/publishedVersion; ; ; ; ; Formato: application/pdf
Publicado em 01/12/1993 Português
Relevância na Pesquisa
66.46%
Determinou-se a dose desinfestante de radiações gama para pêssegos, Prunus persica, infestados com larvas da mosca do Mediterrâneo, Ceratitis capitata. Utilizaram-se frutas de procedência conhecida no campo fazendo-se uma amostragem prévia, constatando-se que cada fruta continha em média nove larvas do último ínstar da mosca praga. As frutas foram irradiadas em uma fonte de Cobalto-60 com as seguintes doses de radiação gama: 0 (test.), 25, 50, 100, 200, 400, 600, 800, 1000 e 1200 Gy, sob uma taxa de 58 Gy por minuto. Após a irradiação as frutas foram colocadas em câmaras climatizadas com a temperatura variando entre 23 e 27°C e a umidade relativa variando entre 65 e 75%. Aguardou-se que as larvas deixassem as frutas e se transformassem em pupas e adultos. A dose letal para larvas, pelos resultados obtidos no experimento, concluiu-se ser de 600 Gy. A dose letal para pupas provenientes de larvas irradiadas dentro das frutas foi de 50 Gy, impedindo totalmente a emergência de adultos.; Determination of the dose of gamma radiation to disinfest peaches, Prunus pérsica infested with larvae of Ceratitis capitata (Wied., 1824) was made. Fruits were collected in the field, each one holding about nine larvae of the last instar of the fruit-fly. The fruits were irradiated with Cobalt-60 gamma radiation source at the following doses: 0 (control)...